Anatomical and Molecular Evidence

Essential Question

How do shared body structures and DNA point to common ancestors?

A human arm, a bat wing, and a whale flipper do very different jobs, yet they are built from the same bones. In this lesson, you’ll compare body structures, embryos, and DNA from different species. You’ll see how each kind of evidence, and the agreement among them, supports the idea that living things share common ancestors.

Homologous Structures

• Homologous structures: same basic design, different jobs
• Inherited from a common ancestor
• The forelimbs of mammals have the same bones
• Different uses come from changes in shape and size

The forelimbs of a human, cat, whale, and bat are used for grasping, walking, swimming, and flying. Yet each limb has the same bones in the same order: one upper bone (the humerus), two lower bones (the radius and ulna), a group of wrist bones (carpals), and digits. Structures like these are homologous structures. The best explanation is that these animals inherited the same basic limb from a common ancestor, and natural selection reshaped it for different uses.

Homologous, Analogous, and Vestigial Structures

• Analogous: similar job, but different structure and origin
• Analogous structures do not show common ancestry
• Vestigial: reduced structures with little or no use
• Vestigial structures are remnants from ancestors

Type	What it is	Example	Shows common ancestry?
Homologous	Similar structure from a common ancestor, often with different functions	Human arm and whale flipper	Yes
Analogous	Similar function but different structure and origin	Wing of a bat and wing of an insect	No. They evolved separately in similar environments.
Vestigial	Reduced structure with little or no function	Tiny hip bones in whales, tailbone in humans	Yes. They are remnants of structures in ancestors.

Not every similarity is evidence of close relationship. A bat’s wing and an insect’s wing both allow flight, but they have different structures and different origins, so they are analogous structures. Similar environments can favor similar solutions in unrelated groups, which is called convergent evolution. Vestigial structures, such as the tiny hip bones of whales, have lost most of their original function. They make sense as leftovers from ancestors that had legs.

Embryos Show Shared Ancestry

• Early vertebrate embryos look alike
• All have pharyngeal pouches and a tail
• Features develop into different adult structures
• Similar development points to shared ancestors

Embryo feature	Present in embryos of	What it becomes
Pharyngeal pouches	Fish, reptiles, birds, mammals (including humans)	Gills in fish; parts of the ear and throat in humans
Tail	Fish, reptiles, birds, mammals (including humans)	Tail in many animals; the tailbone in humans

Early in development, the embryos of fish, reptiles, birds, and mammals share features, such as pharyngeal pouches and a tail. In fish, the pouches become gills. In humans, they become parts of the ear and throat, and the tail becomes the tailbone. It is hard to explain why a human embryo would develop gill-like pouches unless humans inherited this pattern of development from distant ancestors.

DNA and Protein Evidence

• All life uses DNA and the same genetic code
• Related species have more similar DNA and proteins
• Fewer differences mean a more recent common ancestor
• Cytochrome c is a protein found in many species

All living things use DNA and nearly the same genetic code, which is evidence for common ancestry. Comparing the DNA or proteins of different species adds more detail. Mutations build up over time, so the longer two species have been separate, the more differences their DNA and proteins have. The graph compares human cytochrome c, a protein used in cellular respiration, with the same protein in other species (approximate values). Species that we think are closely related to humans, such as chimpanzees and monkeys, have few differences, and distant relatives, such as yeast, have many.

Lines of Evidence Agree

• Fossils, anatomy, embryos, and DNA are independent
• They point to the same family tree
• Agreement from many sources makes the evidence strong

Each type of evidence was discovered separately, by different scientists using different methods. When they are compared, they tell the same story. Species that have homologous structures and similar embryos also tend to have similar DNA, and fossils show the order in which their groups appeared. When many independent lines of evidence agree, scientists have strong confidence in the conclusion, which is why common ancestry is accepted as a well-supported theory.

↑ Back to top

---

Worked Examples

Try each problem on your own first, then open the solution to check your work.

Example 1: Comparing DNA Sequences

The table shows a 20-base section of the same gene in three species. Find the percent of bases that are identical between Species A and Species B, and between Species A and Species C. Which species is more closely related to A?

Species	DNA sequence (20 bases)
A	ATGGCTAAGCTTGACCATGA
B	ATGGCTAAGCTCGACCGTGA
C	ATAGCCAATCTAGATCACGA

Show the solution

1. A and B: the sequences differ at 2 positions (12 and 17), so 20 − 2 = 18 bases match. 18 ÷ 20 × 100 = 90%
2. A and C: the sequences differ at 6 positions (3, 6, 9, 12, 15, 18), so 20 − 6 = 14 bases match. 14 ÷ 20 × 100 = 70%
3. Conclusion: Species B is more similar to A (90% compared with 70%). Fewer DNA differences suggest a more recent common ancestor, so B is more closely related to A.
4. Answer: A and B are 90% identical and A and C are 70% identical, so B is more closely related to A.

Example 2: Cytochrome c Data

Use the graph of cytochrome c differences from humans. (a) Which species has the most similar protein to humans? (b) Which is more closely related to humans, a dog or a chicken? (c) How many more differences does yeast have than tuna?

Show the solution

1. (a) Most similar: the chimpanzee, with 0 differences.
2. (b) Dog or chicken: the dog has 10 differences and the chicken has 13. Fewer differences suggest a more recent common ancestor, so the dog is more closely related to humans.
3. (c) Yeast and tuna: 44 − 21 = 23 more differences.
4. Answer: (a) Chimpanzee. (b) Dog. (c) 23 more.

Example 3: Homologous or Analogous?

(a) Compare the bones of a human arm and a whale flipper. Are they homologous or analogous? (b) A bat’s wing and an insect’s wing are both used for flight. Are they homologous or analogous? Explain each answer.

Show the solution

1. (a) Human arm and whale flipper: homologous. Both have a humerus, a radius and ulna, carpals, and digits in the same order, even though one is used for grasping and the other for swimming. They were inherited from a common mammal ancestor.
2. (b) Bat wing and insect wing: analogous. Both are used for flight, but an insect’s wing is not built from the same bones. The two evolved separately, so they do not show a recent common ancestor.
3. Answer: (a) Homologous (same bones, different jobs). (b) Analogous (same job, different structure).

↑ Back to top

---

Practice

Name bones in a homologous structure, classify structures as homologous or analogous, use protein and DNA data to compare species, and explain a vestigial structure. Try it on your own first, then check your work with the answer key.

• Anatomical and Molecular Evidence Practice Worksheet (PDF)
• Anatomical and Molecular Evidence Practice Answer Key (PDF)

↑ Back to top

---

Lesson Slides

• 4.3 Anatomical and Molecular Evidence Slides (PDF)

↑ Back to top

---

Big Ideas

• Homologous structures: same design from a common ancestor
• Analogous structures: similar job, separate origin
• Vestigial structures are remnants from ancestors
• More similar DNA and proteins mean closer relatives
• Many independent lines of evidence agree

Back to the essential question: fossils, body structures, embryos, and DNA all point to the same conclusion: living things share common ancestors. Homologous and vestigial structures and similar embryos show shared inheritance, and DNA and protein differences measure how closely species are related. Next, you’ll learn how scientists turn this evidence into models of relationships called cladograms.

↑ Back to top

---

↑ Back to top